Hexa^{em2(HEXA)Lmjn}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hexa^{em2(HEXA)Lmjn}
• Name: hexosaminidase A; endonuclease-mediated mutation 2, Lauryl Nutter
• MGI ID: MGI:8238358
• Gene: Hexa Location: Chr9:59446966-59472392 bp, + strand Genetic Position: Chr9, 32.02 cM
• Alliance: Hexa^{em2(HEXA)Lmjn} page

Mutation origin

• Strain of Origin: C57BL/6J-Hexa^{em1(HEXA)Lmjn}/Cmmr

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutation: Insertion
• Hexa^{em2(HEXA)Lmjn} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  HEXA (3073)

  Hexa	(MGI:96073)

• Mutation details:

  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences GCAGTTGTTCATCTACCACC and CGTACATCTGCCTATGATTG. A repair template containing the human HEXA exons 6 to 7 and associated introns (Chr15: 72349475 to 72351575 (hg38) was delivered by incubating embryos with recombinant AAV. Embryos were derived from C57BL/6J-Hexa^em1Lmjn/Lmjn (MGI:7783625) that contains allele Hexa^em1Lmjn (MGI:7783624). In the resulting allele, the mouse exons 6 to12 and associated introns (from Chr9:59464977 to 59470855 (GRCm39)) are replaced by the human sequence (Chr15:72345960 to 72351575). (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hexa Mutation: 28 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)