Etfrf1^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Etfrf1^{em1(IMPC)Hmgu}
• Name: electron transfer flavoprotein regulatory factor 1; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:8234002
• Gene: Etfrf1 Location: Chr6:145156860-145162665 bp, + strand Genetic Position: Chr6, 77.37 cM
• Alliance: Etfrf1^{em1(IMPC)Hmgu} page
• IMPC: Etfrf1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences ATCAAAGAACTTATCGCACG and CTTGGACGGGACTATCCAAA that targeted exon(s) ENSMUSE00000280858.5 ENSMUSE00000688750.2 ENSMUSE00000688758.2 ENSMUSE00000688762.2 ENSMUSE00000688766.2 ENSMUSE00002012764.1 ENSMUSE00002012765.1 ENSMUSE00002012772.1 ENSMUSE00002012773.1 ENSMUSE00002012776.1 ENSMUSE00002012778.1. This resulted in deletion(s) of 92 bp (location: Chr6:145161103-145161194; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Etfrf1 Mutation: 10 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)