About   Help   FAQ
Agpsem1Lmjn
Endonuclease-mediated Allele Detail
Summary
Symbol: Agpsem1Lmjn
Name: alkylglycerone phosphate synthase; endonuclease-mediated mutation 1, Lauryl Nutter
MGI ID: MGI:8211444
Gene: Agps  Location: Chr2:75662521-75761694 bp, + strand  Genetic Position: Chr2, 44.77 cM
Alliance: Agpsem1Lmjn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences GTCCGAAAAGGGATGCTAGT and AGCATCAGTTTAAGTCTGGG. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulted in loxP sites flanking exons ENSMUSE00000329523 and ENSMUSE00000329519 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Agps Mutation:  86 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory