Agpsem1Lmjn
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Agpsem1Lmjn |
| Name: |
alkylglycerone phosphate synthase; endonuclease-mediated mutation 1, Lauryl Nutter |
| MGI ID: |
MGI:8211444 |
| Gene: |
Agps Location: Chr2:75662521-75761694 bp, + strand Genetic Position: Chr2, 44.77 cM
|
| Alliance: |
Agpsem1Lmjn page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, No functional change) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences GTCCGAAAAGGGATGCTAGT and AGCATCAGTTTAAGTCTGGG. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulted in loxP sites flanking exons ENSMUSE00000329523 and ENSMUSE00000329519 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele.
(J:322048)
|
|
|
|
|
| Original: |
J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022; |
| All: |
1 reference(s) |
|