Agps^em1Lmjn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Agps^em1Lmjn
• Name: alkylglycerone phosphate synthase; endonuclease-mediated mutation 1, Lauryl Nutter
• MGI ID: MGI:8211444
• Gene: Agps Location: Chr2:75662521-75761694 bp, + strand Genetic Position: Chr2, 44.77 cM
• Alliance: Agps^em1Lmjn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences GTCCGAAAAGGGATGCTAGT and AGCATCAGTTTAAGTCTGGG. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulted in loxP sites flanking exons ENSMUSE00000329523 and ENSMUSE00000329519 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Agps Mutation: 81 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)