Zfp322a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp322a^em1(IMPC)J
• Name: zinc finger protein 322A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:8210910
• Gene: Zfp322a Location: Chr13:23537273-23553378 bp, - strand Genetic Position: Chr13, 9.55 cM
• Alliance: Zfp322a^em1(IMPC)J page
• IMPC: Zfp322a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGATCTAAGTTCTCACGCAT and TTCTATGGTTCTCTCCTAAG. This resulted in a 512 bp deletion of Chr13:23,356,351-23,356,862 (GRCm38/mm10) that removes exon ENSMUSE00000394779. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp322a Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)