Ptprhem1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ptprhem1(IMPC)Hmgu |
| Name: |
protein tyrosine phosphatase receptor type H; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH |
| MGI ID: |
MGI:8207869 |
| Gene: |
Ptprh Location: Chr7:4551611-4607040 bp, - strand Genetic Position: Chr7, 2.63 cM
|
| Alliance: |
Ptprhem1(IMPC)Hmgu page
|
| IMPC: |
Ptprh gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences ACTGAACAGAGCACCAGCGT, CAAGCCCATTGAGAAACCCG, GTTGGGAGGACGGTCATGCA, and TGGAGCTGAGAATTACAGCG. This resulted in deletion(s) of 438 bp (location: Chr7:4605119-4605556; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ptprh Mutation: |
60 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|