Ptprh^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptprh^{em1(IMPC)Hmgu}
• Name: protein tyrosine phosphatase receptor type H; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:8207869
• Gene: Ptprh Location: Chr7:4551611-4607040 bp, - strand Genetic Position: Chr7, 2.63 cM
• Alliance: Ptprh^{em1(IMPC)Hmgu} page
• IMPC: Ptprh gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences ACTGAACAGAGCACCAGCGT, CAAGCCCATTGAGAAACCCG, GTTGGGAGGACGGTCATGCA, and TGGAGCTGAGAATTACAGCG. This resulted in deletion(s) of 438 bp (location: Chr7:4605119-4605556; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ptprh Mutation: 60 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)