Smim7^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smim7^em1(IMPC)Tcp
• Name: small integral membrane protein 7; endonuclease-mediated mutation 1, Toronto Centre for Phenogenomics
• MGI ID: MGI:8203404
• Gene: Smim7 Location: Chr8:73319042-73324892 bp, - strand Genetic Position: Chr8, 35.08 cM
• Alliance: Smim7^em1(IMPC)Tcp page
• IMPC: Smim7 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AGCCTGGTGAAGCAGCGCGG and TCATAGCTGGCCCGGCAAGC that targeted exon(s) ENSMUSE00000349405.4 ENSMUSE00000391035.6 ENSMUSE00000682212.4 ENSMUSE00000877524.2. This resulted in deletion(s) of 3456 bp (location: Chr8:73321124-73324579; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Smim7 Mutation: 6 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)