Naca^em1Fsl
Endonuclease-mediated Allele Detail

Summary

• Symbol: Naca^em1Fsl
• Name: nascent polypeptide-associated complex alpha polypeptide; endonuclease-mediated mutation 1, Frank Lee
• MGI ID: MGI:8175505
• Synonyms: Naca(AA)
• Gene: Naca Location: Chr10:127871444-127884506 bp, + strand Genetic Position: Chr10, 76.39 cM, cytoband D2-D3
• Alliance: Naca^em1Fsl page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, two guide RNAs (TAGGAGTCTTGTTC CTCGAGCTC and AAACGAGCTCGAGGAACAAGACT) were used to introduce two (L38A/E39A) amino acid substitutions in the nascent polypeptide-associated complex alpha polypeptide (Naca) gene. (J:363102)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Naca Mutation: 73 strains or lines available

References

• Original: J:363102 Song D, et al., The ribosomal chaperone NACA recruits PHD2 to cotranslationally modify HIF-alpha. EMBO J. 2022 Nov 17;41(22):e112059
• All: 1 reference(s)