About   Help   FAQ
Epas1em1Fsl
Endonuclease-mediated Allele Detail
Summary
Symbol: Epas1em1Fsl
Name: endothelial PAS domain protein 1; endonuclease-mediated mutation 1, Frank Lee
MGI ID: MGI:8174634
Synonyms: Hif2aH194R
Gene: Epas1  Location: Chr17:87061292-87140838 bp, + strand  Genetic Position: Chr17, 56.9 cM
Alliance: Epas1em1Fsl page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsUsing CRISPR technology, two guide RNAs (TAGGCCCCAGGTCCTGCACTGCAC and AAACGTGCAGTGCAGGACCTGGGG) were used to introduce A to G point mutation in exon 6 of the endothelial PAS domain protein 1 (Epas1) gene (J:364870)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Epas1 Mutation:  66 strains or lines available
References
Original:  J:364870 Jorgensen K, et al., High-Altitude Andean H194R HIF2A Allele Is a Hypomorphic Allele. Mol Biol Evol. 2023 Jul 5;40(7)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory