Gt(ROSA)26Sor^{em1(Alb-Plg*/PLG)Vlp}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(Alb-Plg*/PLG)Vlp}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Victoria A Ploplis
• MGI ID: MGI:8164186
• Synonyms: ROSA26-mhPG
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(Alb-Plg*/PLG)Vlp} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em1(Alb-Plg*/PLG)Vlp} expresses 2 genes
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  mouse

  Plg (MGI:97620)

  mouse human hybrid

  human

  PLG (5340)

  Plg	(MGI:97620)

  mouse human hybrid

• Gt(ROSA)26Sor^{em1(Alb-Plg*/PLG)Vlp} expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  mouse	Alb (MGI:87991)

• Mutation details:

  gRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert an albumin (Alb) promoter, followed by a Kozak sequence, and a 2.4-kbp mouse/human hybrid plasminogen (Plg/PLG) cDNA with a bGH poly(A) sequence targeted to Gt(ROSA)26Sor locus. Specifically, the (Plg/PLG) cDNA sequence includes the mouse Plg (mPg), consisting of 2 amino acid changes in exon 7 of the kringle-2 (K2) domain (G239R and P241L) in the heavy chain of mPg and a complete replacement of the mPg light chain with the human PLG (hPG) light chain. The mPg cDNA includes the coding sequence from the ATG start code in exon 1 to the end of the heavy chain in exon 13. (J:363733)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1243 strains or lines available

References

• Original: J:363733 Ayinuola YA, et al., Generation and characterization of a plasminogen-binding group A streptococcal M-protein/streptokinase-sensitive mouse line. J Thromb Haemost. 2023 Jun;21(6):1630-1635
• All: 1 reference(s)