Igha^em1Hoet
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igha^em1Hoet
• Name: immunoglobulin heavy constant alpha; endonuclease-mediated mutation 1, Hans C Oettgen
• MGI ID: MGI:8158329
• Synonyms: IgA^-
• Gene: Igha Location: Chr12:113219824-113223856 bp, - strand Genetic Position: Chr12, 62.09 cM
• Alliance: Igha^em1Hoet page

Mutation origin

• Strain of Origin: BALB/cJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A single guide RNA (GGCAGGTGGGAAGTTTACGGTGG) was used to introduce a 1bp deletion in exon 1 of the immunoglobulin heavy constant alpha (Igha) gene on chromosome 12. (J:101977, J:362226)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Igha Mutation: 19 strains or lines available

References

• Original: J:362226 El Ansari YS, et al., T follicular helper cell expansion and hyperimmunoglobulinemia with spontaneous IgE production to dietary antigens in IgA-deficient mice. Mucosal Immunol. 2025 Jan 15
• All: 2 reference(s)