Zc3h15em1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zc3h15em1(IMPC)Hmgu |
| Name: |
zinc finger CCCH-type containing 15; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH |
| MGI ID: |
MGI:7864006 |
| Gene: |
Zc3h15 Location: Chr2:83474922-83494961 bp, + strand Genetic Position: Chr2, 49.33 cM, cytoband E1
|
| Alliance: |
Zc3h15em1(IMPC)Hmgu page
|
| IMPC: |
Zc3h15 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences AACTATCAATCCAAGCTCCC and TAGACCCCATCTAGTTGCAG that targeted exon(s) ENSMUSE00001223230.2 ENSMUSE00001273246.2 ENSMUSE00001812145.1 ENSMUSE00001812148.1. This resulted in deletion(s) of 2531 bp (location: Chr2:83486184-83488714; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|