Tnnt2^em1Jcsm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnnt2^em1Jcsm
• Name: troponin T2, cardiac; endonuclease-mediated mutation 1, James Smith
• MGI ID: MGI:7859265
• Gene: Tnnt2 Location: Chr1:135764092-135779998 bp, + strand Genetic Position: Chr1, 59.32 cM
• Alliance: Tnnt2^em1Jcsm page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:101977
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: A sgRNA (TTTCATCTATTTCCAACGCC) was designed to target the C-terminal of the troponin T2, cardiac (Tnnt2) gene with a virus-derived T2A self-cleaving sequence that mediates ribosomal skipping fused to an enhanced green fluorescent protein (EGFP) sequence. sgRNA, donor plasmid, and the Cas9 RNA were electroporated into the cytoplasm of C57BL/6N-derived embryonic stem (ES) cells. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tnnt2 Mutation: 51 strains or lines available

Notes

Lentiviral gene trap injected into zygotes.

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)