Iho1em1Atot
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Iho1em1Atot |
| Name: |
interactor of HORMAD1 1; endonuclease-mediated mutation 1, Attila Toth |
| MGI ID: |
MGI:7857221 |
| Synonyms: |
Iho1C7delta |
| Gene: |
Iho1 Location: Chr9:108280810-108305683 bp, - strand Genetic Position: Chr9, 59.32 cM
|
| Alliance: |
Iho1em1Atot page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Altered localization) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: CRISPR/cas9 mediated recombination using a guide RNA (GGATTTTGATAGCAGCGATGATA) resulted in the insertion of a T causing a frameshift and premature stop codon. The resulting protein lacks the last 7 amino acids. Testicular expression levels of the truncated protein are similar to wild-type protein expression; however, protien is depleted from the chromatin-enriched fractions of testis extracts.
(J:361361)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Iho1 Mutation: |
26 strains or lines available
|
|
| Original: |
J:361361 Dereli I, et al., Seeding the meiotic DNA break machinery and initiating recombination on chromosome axes. Nat Commun. 2024 Apr 5;15(1):2941 |
| All: |
1 reference(s) |
|