Iho1^em1Atot
Endonuclease-mediated Allele Detail

Summary

• Symbol: Iho1^em1Atot
• Name: interactor of HORMAD1 1; endonuclease-mediated mutation 1, Attila Toth
• MGI ID: MGI:7857221
• Synonyms: Iho1^C7delta
• Gene: Iho1 Location: Chr9:108280810-108305683 bp, - strand Genetic Position: Chr9, 59.32 cM
• Alliance: Iho1^em1Atot page

Mutation origin

• Strain of Origin: C57BL/6JCrl

Mutation description

• Allele Type: Endonuclease-mediated (Altered localization)
• Mutation: Single point mutation
• Mutation details: CRISPR/cas9 mediated recombination using a guide RNA (GGATTTTGATAGCAGCGATGATA) resulted in the insertion of a T causing a frameshift and premature stop codon. The resulting protein lacks the last 7 amino acids. Testicular expression levels of the truncated protein are similar to wild-type protein expression; however, protien is depleted from the chromatin-enriched fractions of testis extracts. (J:361361)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Iho1 Mutation: 27 strains or lines available

References

• Original: J:361361 Dereli I, et al., Seeding the meiotic DNA break machinery and initiating recombination on chromosome axes. Nat Commun. 2024 Apr 5;15(1):2941
• All: 1 reference(s)