About   Help   FAQ
Iho1em1Atot
Endonuclease-mediated Allele Detail
Summary
Symbol: Iho1em1Atot
Name: interactor of HORMAD1 1; endonuclease-mediated mutation 1, Attila Toth
MGI ID: MGI:7857221
Synonyms: Iho1C7delta
Gene: Iho1  Location: Chr9:108280810-108305683 bp, - strand  Genetic Position: Chr9, 59.32 cM
Alliance: Iho1em1Atot page
Mutation
origin
Strain of Origin:  C57BL/6JCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Altered localization)
Mutation:    Single point mutation
 
Mutation detailsCRISPR/cas9 mediated recombination using a guide RNA (GGATTTTGATAGCAGCGATGATA) resulted in the insertion of a T causing a frameshift and premature stop codon. The resulting protein lacks the last 7 amino acids. Testicular expression levels of the truncated protein are similar to wild-type protein expression; however, protien is depleted from the chromatin-enriched fractions of testis extracts. (J:361361)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Iho1 Mutation:  26 strains or lines available
References
Original:  J:361361 Dereli I, et al., Seeding the meiotic DNA break machinery and initiating recombination on chromosome axes. Nat Commun. 2024 Apr 5;15(1):2941
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory