Rr406431^em1Zzz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr406431^em1Zzz
• Name: regulatory region 406431; endonuclease-mediated mutation 1, Zhuangzhi Zhang
• MGI ID: MGI:7857007
• Synonyms: hs599^-
• Gene: Rr406431 Location: Chr2:116153883-116155547 bp, . strand Genetic Position: Chr2, Syntenic
• Alliance: Rr406431^em1Zzz page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Meis2 enhancer, located downstream, was targeted using sgRNAs (equivalent to CACCGAGTAAGGTGACCAGCAGG and AAAAGAAGCGAAGGTCGGGAGGG) with CRISPR/Cas9 technology, resulting in a 2009 bp deletion. This leads to reduced expression of Meis2 in lateral ganglionic eminence (LGE) subventricular zone (SVZ). (J:321980)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr406431 Mutation: 0 strains or lines available

References

• Original: J:321980 Su Z, et al., Dlx1/2-dependent expression of Meis2 promotes neuronal fate determination in the mammalian striatum. Development. 2022 Feb 15;149(4):dev200035
• All: 1 reference(s)