About   Help   FAQ
Rr406431em1Zzz
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr406431em1Zzz
Name: regulatory region 406431; endonuclease-mediated mutation 1, Zhuangzhi Zhang
MGI ID: MGI:7857007
Synonyms: hs599-
Gene: Rr406431  Location: Chr2:116153883-116155547 bp, . strand  Genetic Position: Chr2, Syntenic
Alliance: Rr406431em1Zzz page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Meis2 enhancer, located downstream, was targeted using sgRNAs (equivalent to CACCGAGTAAGGTGACCAGCAGG and AAAAGAAGCGAAGGTCGGGAGGG) with CRISPR/Cas9 technology, resulting in a 2009 bp deletion. This leads to reduced expression of Meis2 in lateral ganglionic eminence (LGE) subventricular zone (SVZ). (J:321980)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr406431 Mutation:  0 strains or lines available
References
Original:  J:321980 Su Z, et al., Dlx1/2-dependent expression of Meis2 promotes neuronal fate determination in the mammalian striatum. Development. 2022 Feb 15;149(4):dev200035
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory