Rr544em2Qli
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr544em2Qli |
| Name: |
regulatory region 544; endonuclease-mediated mutation 2, Qian Li |
| MGI ID: |
MGI:7856730 |
| Synonyms: |
TAAR enhancer 1 & 2 double knockout |
| Gene: |
Rr544 Location: Chr10:23806280-23806978 bp Genetic Position: Chr10, Syntenic
|
| Alliance: |
Rr544em2Qli page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: Taar enhancer TE1, located between Taar1 and Taar2, was targeted using sgRNAs (targeting TGGTTGTGAGTTGCTTGTGG, TCAGCCTGTTAATTACCTGA, AGAACTTTCAGAGAGTTCCC, GAACCCAGAACTGACTTTTG, TATTCTAGAAATACAGATGT and AGCATCCTGGAGGTGAAATG) with CRISPR/Cas9 technology, resulting in a 1205 bp deletion (GRCm39:chr10:23805948-23807152). This allele was created in zygotes carrying the Rr545em1Qli TE2 deletion allele. This leads to the reduction in expression of most Taar genes without affecting olfactory gene expression.
(J:322210)
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr544 Mutation: |
0 strains or lines available
|
|
| Original: |
J:322210 Fei A, et al., Coordination of two enhancers drives expression of olfactory trace amine-associated receptors. Nat Commun. 2021 Jun 18;12(1):3798 |
| All: |
1 reference(s) |
|