About   Help   FAQ
Rr544em2Qli
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr544em2Qli
Name: regulatory region 544; endonuclease-mediated mutation 2, Qian Li
MGI ID: MGI:7856730
Synonyms: TAAR enhancer 1 & 2 double knockout
Gene: Rr544  Location: Chr10:23806280-23806978 bp  Genetic Position: Chr10, Syntenic
Alliance: Rr544em2Qli page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsTaar enhancer TE1, located between Taar1 and Taar2, was targeted using sgRNAs (targeting TGGTTGTGAGTTGCTTGTGG, TCAGCCTGTTAATTACCTGA, AGAACTTTCAGAGAGTTCCC, GAACCCAGAACTGACTTTTG, TATTCTAGAAATACAGATGT and AGCATCCTGGAGGTGAAATG) with CRISPR/Cas9 technology, resulting in a 1205 bp deletion (GRCm39:chr10:23805948-23807152). This allele was created in zygotes carrying the Rr545em1Qli TE2 deletion allele. This leads to the reduction in expression of most Taar genes without affecting olfactory gene expression. (J:322210)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr544 Mutation:  0 strains or lines available
References
Original:  J:322210 Fei A, et al., Coordination of two enhancers drives expression of olfactory trace amine-associated receptors. Nat Commun. 2021 Jun 18;12(1):3798
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory