Rr545^em1Qli
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr545^em1Qli
• Name: regulatory region 545; endonuclease-mediated mutation 1, Qian Li
• MGI ID: MGI:7856727
• Synonyms: TAAR enhancer 2 -
• Gene: Rr545 Location: Chr10:23863682-23864027 bp Genetic Position: Chr10, Syntenic
• Alliance: Rr545^em1Qli page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Taar enhancer TE2, located between Taar6 and Taar7a, was targeted using sgRNAs (targeting GTAAATAAAAACTTTCCCTC, CTCCATCGTCACAAAGCCTG, CCCTCAAAAAGTTTGTTTTT and CAGGTCTTTTTTAGTGGACT) with CRISPR/Cas9 technology, resulting in a 1433 bp deletion (GRCm39:chr10:23863270-23864702). This leads to the reduction in expression of a number of Taar genes without affecting olfactory gene expression. (J:322210)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr545 Mutation: 0 strains or lines available

References

• Original: J:322210 Fei A, et al., Coordination of two enhancers drives expression of olfactory trace amine-associated receptors. Nat Commun. 2021 Jun 18;12(1):3798
• All: 2 reference(s)