Rr598^em3Yagk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr598^em3Yagk
• Name: regulatory region 598; endonuclease-mediated mutation 3, Yana G Kamberov
• MGI ID: MGI:7856495
• Synonyms: hECE18^KI
• Gene: Rr598 Location: unknown Genetic Position: Chr1, Syntenic
• Alliance: Rr598^em3Yagk page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutations: Insertion, Intragenic deletion
• Mutation details: The En1 enhancer, located downstream in an intron of Celrr, was targeted using sgRNAs (equivalent to CAGAATCAATATAAGCCCCAGGG and TTCTTCCGGACCATGGACTAGGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the replacement of mouse enhancer sequence (GRCm39:chr1:121024493-121025555) with the equivalent human enhancer sequence (GRCh38:chr2:118309555-118310531). (J:306748)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr598 Mutation: 0 strains or lines available

References

• Original: J:306748 Aldea D, et al., Repeated mutation of a developmental enhancer contributed to human thermoregulatory evolution. Proc Natl Acad Sci U S A. 2021 Apr 20;118(16):e2021722118
• All: 1 reference(s)