Rr598^em1Yagk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr598^em1Yagk
• Name: regulatory region 598; endonuclease-mediated mutation 1, Yana G Kamberov
• MGI ID: MGI:7855985
• Synonyms: mECE18^del, mECE18^KO
• Gene: Rr598 Location: unknown Genetic Position: Chr1, Syntenic
• Alliance: Rr598^em1Yagk page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The En1 enhancer, located downstream in an intron of Celrr, was targeted using sgRNAs (equivalent to CAGAATCAATATAAGCCCCAGGG and TTCTTCCGGACCATGGACTAGGG) with CRISPR/Cas9 technology, resulting in a 1486 bp deletion (GRCm39:chr1:121024265-121025750). (J:306748)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr598 Mutation: 0 strains or lines available

References

• Original: J:306748 Aldea D, et al., Repeated mutation of a developmental enhancer contributed to human thermoregulatory evolution. Proc Natl Acad Sci U S A. 2021 Apr 20;118(16):e2021722118
• All: 2 reference(s)