About   Help   FAQ
Rr595em1Weij
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr595em1Weij
Name: regulatory region 595; endonuclease-mediated mutation 1, Wei Jiang
MGI ID: MGI:7855055
Gene: Rr595  Location: unknown  Genetic Position: Chr2, Syntenic
Alliance: Rr595em1Weij page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Modified regulatory region)
Mutation:    Single point mutation
 
Mutation detailsA single nucleotide mutation (GRCm39:chr2:g.147882499A>G), in an intergenic region, was engineered using sgRNAs (equivalent to GCCCCCCCAGTTCCAAGTTTAGG and CACAGAGTCCGCCCCCCACTCGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of human non-coding SNP rs6048205 (NC_000020.11:22578963:A>G), associated with higher fasting-glucose levels and impaired beta cell function. The mutation leads to higher Foxa2 expression levels in pancreatic progenitor cells. (J:358609)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr595 Mutation:  0 strains or lines available
References
Original:  J:358609 Li Y, et al., A noncoding variant confers pancreatic differentiation defect and contributes to diabetes susceptibility by recruiting RXRA. Nat Commun. 2024 Nov 12;15(1):9771
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory