Rr595^em1Weij
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr595^em1Weij
• Name: regulatory region 595; endonuclease-mediated mutation 1, Wei Jiang
• MGI ID: MGI:7855055
• Gene: Rr595 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr595^em1Weij page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Modified regulatory region)
• Mutation: Single point mutation
• Mutation details: A single nucleotide mutation (GRCm39:chr2:g.147882499A>G), in an intergenic region, was engineered using sgRNAs (equivalent to GCCCCCCCAGTTCCAAGTTTAGG and CACAGAGTCCGCCCCCCACTCGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of human non-coding SNP rs6048205 (NC_000020.11:22578963:A>G), associated with higher fasting-glucose levels and impaired beta cell function. The mutation leads to higher Foxa2 expression levels in pancreatic progenitor cells. (J:358609)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr595 Mutation: 0 strains or lines available

References

• Original: J:358609 Li Y, et al., A noncoding variant confers pancreatic differentiation defect and contributes to diabetes susceptibility by recruiting RXRA. Nat Commun. 2024 Nov 12;15(1):9771
• All: 1 reference(s)