About   Help   FAQ
Tcf7l2em1Rudl
Endonuclease-mediated Allele Detail
Summary
Symbol: Tcf7l2em1Rudl
Name: transcription factor 7 like 2, T cell specific, HMG box; endonuclease-mediated mutation 1, Christiane Ruedl
MGI ID: MGI:7852267
Gene: Tcf7l2  Location: Chr19:55730252-55922086 bp, + strand  Genetic Position: Chr19, 51.59 cM
Alliance: Tcf7l2em1Rudl page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:101977
Parent Cell Line:  W4 (ES Cell)
Strain of Origin:  129S6/SvEvTac
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible)
Inducer:    doxycycline/tetracycline
Mutation:    Insertion
 
Mutation detailsUsing CRISPR-cas9 technology, a tetO was inserted into intron 3 of the transcription factor 7 like 2, T cell specific, HMG box (Tcf7l2) gene (based on Tcf7l2 ENSMUST00000111656.8). A sgRNA (GTGCGTCTTGGGCTTTCCCC) designed to target the Tcf7l2 locus was used to insert this TRE)mod( sequence (from pTREtight vector) via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells. Endogenous Tcf7l2 mRNA expression and splicing were unaffected. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tcf7l2 Mutation:  57 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory