Pole^em3Ewht
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pole^em3Ewht
• Name: polymerase (DNA directed), epsilon; endonuclease-mediated mutation 3, Eileen White
• MGI ID: MGI:7797733
• Synonyms: LSL-Pole V411L
• Gene: Pole Location: Chr5:110434185-110485319 bp, + strand Genetic Position: Chr5, 53.45 cM, cytoband E3-E5
• Alliance: Pole^em3Ewht page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: Using CRISPR technology, a sgRNA (AGTGGAGGCTCAAGTGGCAT) was designed to target the Pole gene to introduce Lox-Stop-Lox cassette and a GTG to CTT mutation in exon 13 resulting in a valine to leucine change at amino acid 411 (V411L). (J:364251)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pole Mutation: 102 strains or lines available

References

• Original: J:364251 Sawant A, et al., Immune Checkpoint Blockade Delays Cancer Development and Extends Survival in DNA Polymerase Mutator Syndromes. Cancer Res. 2025 Mar 14;85(6):1130-1144
• All: 1 reference(s)