About   Help   FAQ
Poleem2Ewht
Endonuclease-mediated Allele Detail
Summary
Symbol: Poleem2Ewht
Name: polymerase (DNA directed), epsilon; endonuclease-mediated mutation 2, Eileen White
MGI ID: MGI:7797731
Synonyms: Pole L424V
Gene: Pole  Location: Chr5:110434185-110485319 bp, + strand  Genetic Position: Chr5, 53.45 cM, cytoband E3-E5
Alliance: Poleem2Ewht page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (equivalent to TGTGGGCAGTCATAATCTCA) and an ssODN template with CRISPR/Cas9 technology, codon 424 was changed from leucine (CTC) to valine (GTT) (g.GRCm39:chr5:110444915_110444917CTC>GTT, p.L424V) (J:364251)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pole Mutation:  103 strains or lines available
References
Original:  J:364251 Sawant A, et al., Immune Checkpoint Blockade Delays Cancer Development and Extends Survival in DNA Polymerase Mutator Syndromes. Cancer Res. 2025 Mar 14;85(6):1130-1144
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory