Rr589^em2Pike
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr589^em2Pike
• Name: regulatory region 589; endonuclease-mediated mutation 2, J Wesley Pike
• MGI ID: MGI:7790909
• Synonyms: M1-IKOP
• Gene: Rr589 Location: unknown Genetic Position: Chr10, Syntenic
• Alliance: Rr589^em2Pike page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The Cyp27b1 enhancer, located in a Mettl1 intron, was targeted using sgRNAs (equivalent to GTTGTTCTGTCTAGCTCCAGTGG and GCGTCAGAGATCAGCTCCAGTGG) with CRISPR/Cas9 technology, resulting in an 86 bp deletion (GRCm39:chr10:126879317-126879402). (J:281102)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr589 Mutation: 0 strains or lines available

References

• Original: J:281102 Meyer MB, et al., Targeted genomic deletions identify diverse enhancer functions and generate a kidney-specific, endocrine-deficient Cyp27b1 pseudo-null mouse. J Biol Chem. 2019 Jun 14;294(24):9518-9535
• All: 1 reference(s)