Rr589em2Pike
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr589em2Pike |
| Name: |
regulatory region 589; endonuclease-mediated mutation 2, J Wesley Pike |
| MGI ID: |
MGI:7790909 |
| Synonyms: |
M1-IKOP |
| Gene: |
Rr589 Location: unknown Genetic Position: Chr10, Syntenic
|
| Alliance: |
Rr589em2Pike page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The Cyp27b1 enhancer, located in a Mettl1 intron, was targeted using sgRNAs (equivalent to GTTGTTCTGTCTAGCTCCAGTGG and GCGTCAGAGATCAGCTCCAGTGG) with CRISPR/Cas9 technology, resulting in an 86 bp deletion (GRCm39:chr10:126879317-126879402).
(J:281102)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr589 Mutation: |
0 strains or lines available
|
|
| Original: |
J:281102 Meyer MB, et al., Targeted genomic deletions identify diverse enhancer functions and generate a kidney-specific, endocrine-deficient Cyp27b1 pseudo-null mouse. J Biol Chem. 2019 Jun 14;294(24):9518-9535 |
| All: |
1 reference(s) |
|