About   Help   FAQ
Rr589em1Pike
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr589em1Pike
Name: regulatory region 589; endonuclease-mediated mutation 1, J Wesley Pike
MGI ID: MGI:7790908
Synonyms: M1-IKO
Gene: Rr589  Location: unknown  Genetic Position: Chr10, Syntenic
Alliance: Rr589em1Pike page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe Cyp27b1 enhancer, located in a Mettl1 intron, was targeted using sgRNAs (equivalent to GATTAGTTGACCTTTCCTCCTGG and CAGGAACTCCAGACCATGAGAGG) with CRISPR/Cas9 technology, resulting in a 324 bp deletion (GRCm39:chr10:126879179-126879502). (J:281102)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr589 Mutation:  0 strains or lines available
References
Original:  J:281102 Meyer MB, et al., Targeted genomic deletions identify diverse enhancer functions and generate a kidney-specific, endocrine-deficient Cyp27b1 pseudo-null mouse. J Biol Chem. 2019 Jun 14;294(24):9518-9535
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory