Rr588^em1Pike
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr588^em1Pike
• Name: regulatory region 588; endonuclease-mediated mutation 1, J Wesley Pike
• MGI ID: MGI:7790880
• Synonyms: C24-DS1 KO
• Gene: Rr588 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr588^em1Pike page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Cyp24a1 renal super-enhancer containing vitamin-D-response-elements, located downstream, was targeted using sgRNAs (equivalent to TAGGGACAAGGCATCAGACGAGG and AGAGTCGAGCGGAAATGTGCAGG) with CRISPR/Cas9 technology, resulting in an ~17.5 kb deletion. (J:359838)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr588 Mutation: 0 strains or lines available

References

• Original: J:359838 Meyer MB, et al., A chromatin-based mechanism controls differential regulation of the cytochrome P450 gene Cyp24a1 in renal and non-renal tissues. J Biol Chem. 2019 Sep 27;294(39):14467-14481
• All: 1 reference(s)