Rr56163^em1Mabm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr56163^em1Mabm
• Name: regulatory region 56163; endonuclease-mediated mutation 1, Mark B Meyer
• MGI ID: MGI:7790791
• Synonyms: C24-V1V2
• Gene: Rr56163 Location: Chr2:170338200-170339601 bp Genetic Position: Chr2, Syntenic
• Alliance: Rr56163^em1Mabm page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Nucleotide substitutions
• Mutation details: The Cyp24a1 proximal promoter region was targeted using sgRNAs (equivalent to GGGGACCGACTGGCAAGGATGGG and CGCTTGCACAATCGCCACTCAGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the mutation of an AP1-binding site from GAGTCA to tttTgt, vitamin-D-response-element 1 (VDRE1) from AGGTGAGTGAGGGCG to ttcTGccTGtttGCG and VDRE2 from GGTTCAGCGGGTGCG to aaTTtAGCtaaccCG. (J:359655)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr56163 Mutation: 0 strains or lines available

References

• Original: J:359655 Meyer MB, et al., In Vivo Contribution of Cyp24a1 Promoter Vitamin D Response Elements. Endocrinology. 2024 Sep 26;165(11)
• All: 1 reference(s)