Rr587^em4Mam
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr587^em4Mam
• Name: regulatory region 587; endonuclease-mediated mutation 4, Lothar Hennighausen
• MGI ID: MGI:7790525
• Synonyms: E1 31 bp del
• Gene: Rr587 Location: unknown Genetic Position: Chr5, Syntenic
• Alliance: Rr587^em4Mam page

Mutation origin

• Strain of Origin: (C57BL/6J x DBA/2J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Klotho enhancer E1, located upstream, was targeted using an sgRNA (equivalent to CTTCTTTCAGTGTGTCGCTTAAA) with CRISPR/Cas9 technology, resulting in a 31 bp deletion (GRCm39:chr5:150836344-150836374) that leads to a reduction in Klotho expression. (J:359659)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr587 Mutation: 0 strains or lines available

References

• Original: J:359659 Jankowski J, et al., Sexually dimorphic renal expression of mouse Klotho is directed by a kidney-specific distal enhancer responsive to HNF1b. Commun Biol. 2024 Sep 14;7(1):1142
• All: 1 reference(s)