Rr587em3Mam
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr587em3Mam |
| Name: |
regulatory region 587; endonuclease-mediated mutation 3, Lothar Hennighausen |
| MGI ID: |
MGI:7790524 |
| Synonyms: |
E1 145 bp del |
| Gene: |
Rr587 Location: unknown Genetic Position: Chr5, Syntenic
|
| Alliance: |
Rr587em3Mam page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: Klotho enhancer E1, located upstream, was targeted using an sgRNA (equivalent to CTTCTTTCAGTGTGTCGCTTAAA) with CRISPR/Cas9 technology, resulting in a 145 bp deletion (GRCm39:chr5:150836248-150836392) that leads to a reduction in Klotho expression.
(J:359659)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr587 Mutation: |
0 strains or lines available
|
|
| Original: |
J:359659 Jankowski J, et al., Sexually dimorphic renal expression of mouse Klotho is directed by a kidney-specific distal enhancer responsive to HNF1b. Commun Biol. 2024 Sep 14;7(1):1142 |
| All: |
1 reference(s) |
|