About   Help   FAQ
Rr587em1Mam
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr587em1Mam
Name: regulatory region 587; endonuclease-mediated mutation 1, Lothar Hennighausen
MGI ID: MGI:7790521
Synonyms: E1 1744 bp del, E1 KO
Gene: Rr587  Location: unknown  Genetic Position: Chr5, Syntenic
Alliance: Rr587em1Mam page
Mutation
origin
Strain of Origin:  (C57BL/6J x DBA/2J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsKlotho enhancer E1, located upstream, was targeted using an sgRNA (equivalent to CTTCTTTCAGTGTGTCGCTTAAA) with CRISPR/Cas9 technology, resulting in a 1744 bp deletion (GRCm39:chr5:150834640-150836383) that leads to a reduction in Klotho expression. (J:359659)
Expression
In Mice Carrying this Mutation: 2 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr587 Mutation:  0 strains or lines available
References
Original:  J:359659 Jankowski J, et al., Sexually dimorphic renal expression of mouse Klotho is directed by a kidney-specific distal enhancer responsive to HNF1b. Commun Biol. 2024 Sep 14;7(1):1142
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory