About   Help   FAQ
Rr584em2Itan
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr584em2Itan
Name: regulatory region 584; endonuclease-mediated mutation 2, Ichiro Taniuchi
MGI ID: MGI:7790509
Synonyms: Satb1deltaa, Satb1deltaEth2
Gene: Rr584  Location: unknown  Genetic Position: Chr17, Syntenic
Alliance: Rr584em2Itan page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutations:    Intergenic deletion, Intragenic deletion
 
Mutation detailsThe Satb1 IL4-responsive TH2-specific enhancer was targeted using sgRNAs (equivalent to GGATTGAAGTGTTCGCATGT and CAGTCAACATCAGAATTTCT) with CRISPR/Cas9 technology, resulting in an 828 bp deletion (GRCm39:chr17:52469270-52470097). (J:359291)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr584 Mutation:  0 strains or lines available
References
Original:  J:359291 Nomura A, et al., Identification of a novel enhancer essential for Satb1 expression in T(H)2 cells and activated ILC2s. Life Sci Alliance. 2023 Aug;6(8)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory