Rr584^em1Itan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr584^em1Itan
• Name: regulatory region 584; endonuclease-mediated mutation 1, Ichiro Taniuchi
• MGI ID: MGI:7790505
• Synonyms: Satb1^deltaa, Satb1^deltaEth2
• Gene: Rr584 Location: unknown Genetic Position: Chr17, Syntenic
• Alliance: Rr584^em1Itan page

Mutation origin

• Strain of Origin: 129 x C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutations: Intergenic deletion, Intragenic deletion
• Mutation details: The Satb1 IL4-responsive TH2-specific enhancer was targeted using sgRNAs (equivalent to GGATTGAAGTGTTCGCATGT and CAGTCAACATCAGAATTTCT) with CRISPR/Cas9 technology, resulting in an 828 bp deletion (GRCm39:chr17:52469270-52470097). This allele was created in ES cells carrying the Satb1^tm1Itan allele on the paternal chromosome and mice carrying the two alleles on the same chromosome were selected. (J:359291)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr584 Mutation: 0 strains or lines available

References

• Original: J:359291 Nomura A, et al., Identification of a novel enhancer essential for Satb1 expression in T(H)2 cells and activated ILC2s. Life Sci Alliance. 2023 Aug;6(8)
• All: 1 reference(s)