Svs3b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Svs3b^em1(IMPC)J
• Name: seminal vesicle secretory protein 3B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7789056
• Gene: Svs3b Location: Chr2:164096283-164098560 bp, - strand Genetic Position: Chr2, 84.91 cM
• Alliance: Svs3b^em1(IMPC)J page
• IMPC: Svs3b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTTTTCTGGGTGCAGAAAGG and CATACACCACCTAGAAATAC. This resulted in a 1,171 bp deletion of Chr2:164,255,520-164,256,690 (GRCm38/mm10) that removes exon ENSMUSE00000998160 and/through ENSMUSE00001082815. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Svs3b Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)