Zfp169^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp169^em1(IMPC)J
• Name: zinc finger protein 169; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7787112
• Gene: Zfp169 Location: Chr13:48641123-48666927 bp, - strand Genetic Position: Chr13, 24.81 cM
• Alliance: Zfp169^em1(IMPC)J page
• IMPC: Zfp169 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AAGCAAAGGCACGCCCACAC and GAGGGCTCTAATTCTGTCCT. This resulted in a 1,875 bp deletion of Chr13:48,489,515-48,491,389 (GRCm38/mm10) that removes exon ENSMUSE00000957831. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp169 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)