Tmem229a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem229a^em1(IMPC)J
• Name: transmembrane protein 229A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7787088
• Gene: Tmem229a Location: Chr6:24951140-24956124 bp, - strand Genetic Position: Chr6, 11.29 cM
• Alliance: Tmem229a^em1(IMPC)J page
• IMPC: Tmem229a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTGCACCCGCCACAACACGT and GGCAGCGATGTGGCGAGTGA. This resulted in a 1,070 bp deletion of Chr6:24,954,662-24,955,731 (GRCm38/mm10) that removes exon ENSMUSE00000760245. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem229a Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)