About   Help   FAQ
Rr583em2Kejz
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr583em2Kejz
Name: regulatory region 583; endonuclease-mediated mutation 2, Keji Zhao
MGI ID: MGI:7786758
Synonyms: CNS-28delta
Gene: Rr583  Location: unknown  Genetic Position: Chr10, Syntenic
Alliance: Rr583em2Kejz page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsIfng silencer CNS-28, located upstream, was targeted using sgRNAs (equivalent to ATTAAGACCTCGTTGAAGGC and GAGATCTTATCATGCCGTCT) with CRISPR/Cas9 technology, resulting in an ~150 bp deletion. (J:335541)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr583 Mutation:  0 strains or lines available
References
Original:  J:335541 Cui K, et al., Restraint of IFN-gamma expression through a distal silencer CNS-28 for tissue homeostasis. Immunity. 2023 May 9;56(5):944-958.e6
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory