Rr583^em1Kejz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr583^em1Kejz
• Name: regulatory region 583; endonuclease-mediated mutation 1, Keji Zhao
• MGI ID: MGI:7786756
• Synonyms: G28^delta
• Gene: Rr583 Location: unknown Genetic Position: Chr10, Syntenic
• Alliance: Rr583^em1Kejz page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Ifng silencer CNS-28, located upstream, was targeted using sgRNAs (equivalent to AATTAAGTCTTAACAGAAGGAGG and ACTCTGCATGGTTCCCATTTGG) with CRISPR/Cas9 technology, resulting in an ~1 kb deletion. (J:335541)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr583 Mutation: 0 strains or lines available

References

• Original: J:335541 Cui K, et al., Restraint of IFN-gamma expression through a distal silencer CNS-28 for tissue homeostasis. Immunity. 2023 May 9;56(5):944-958.e6
• All: 1 reference(s)