About   Help   FAQ
Rr578em2Krum
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr578em2Krum
Name: regulatory region 578; endonuclease-mediated mutation 2, Robb Krumlauf
MGI ID: MGI:7786710
Synonyms: ENE-
Gene: Rr578  Location: unknown  Genetic Position: Chr11, Syntenic
Alliance: Rr578em2Krum page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Nucleotide substitutions
 
Mutation detailsThe Hoxb enhancer ENE retinoic acid response element (ENE-RARE) was targeted for binding site disruption using an sgRNA (equivalent to GAGGAGGAAGAGTTCATGGAG) and an ssODN template with CRISPR/Cas9 technology, changing it from AGTTCAtggagAGGCCA to ACCAAGtggacTGAATT. This allele was created in ES cells carrying the Rr577em2Krum alleles. (J:336097)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr578 Mutation:  0 strains or lines available
References
Original:  J:336097 Afzal Z, et al., Shared retinoic acid responsive enhancers coordinately regulate nascent transcription of Hoxb coding and non-coding RNAs in the developing mouse neural tube. Development. 2023 May 15;150(10)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory