Rr578^em2Krum
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr578^em2Krum
• Name: regulatory region 578; endonuclease-mediated mutation 2, Robb Krumlauf
• MGI ID: MGI:7786710
• Synonyms: ENE^-
• Gene: Rr578 Location: unknown Genetic Position: Chr11, Syntenic
• Alliance: Rr578^em2Krum page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Nucleotide substitutions
• Mutation details: The Hoxb enhancer ENE retinoic acid response element (ENE-RARE) was targeted for binding site disruption using an sgRNA (equivalent to GAGGAGGAAGAGTTCATGGAG) and an ssODN template with CRISPR/Cas9 technology, changing it from AGTTCAtggagAGGCCA to ACCAAGtggacTGAATT. This allele was created in ES cells carrying the Rr577^em2Krum alleles. (J:336097)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr578 Mutation: 0 strains or lines available

References

• Original: J:336097 Afzal Z, et al., Shared retinoic acid responsive enhancers coordinately regulate nascent transcription of Hoxb coding and non-coding RNAs in the developing mouse neural tube. Development. 2023 May 15;150(10)
• All: 1 reference(s)