Rr577em2Krum
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr577em2Krum |
| Name: |
regulatory region 577; endonuclease-mediated mutation 2, Robb Krumlauf |
| MGI ID: |
MGI:7786709 |
| Synonyms: |
B4U- |
| Gene: |
Rr577 Location: unknown Genetic Position: Chr11, Syntenic
|
| Alliance: |
Rr577em2Krum page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: The Hoxb enhancer B4U retinoic acid response element (B4U-RARE) was targeted for binding site disruption using an sgRNA (equivalent to GAGGGGTGAACCGCAGGTCA) and an ssODN template with CRISPR/Cas9 technology, changing it from GGGTGAaccgcAGGTCA to GAATTCaccagTTCTCA. This allele was created in ES cells carrying the
Find Mice (IMSR) |
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr577 Mutation: |
0 strains or lines available
|
|
| Original: |
J:336097 Afzal Z, et al., Shared retinoic acid responsive enhancers coordinately regulate nascent transcription of Hoxb coding and non-coding RNAs in the developing mouse neural tube. Development. 2023 May 15;150(10) |
| All: |
1 reference(s) |
|
This site uses cookies.
Some cookies are essential for site operations and others help us analyze use and utility of our web site.
Please refer to our
privacy policy
for more information.
| |
Analysis Tools
