About   Help   FAQ
Bicralem2(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Bicralem2(IMPC)J
Name: BRD4 interacting chromatin remodeling complex associated protein like; endonuclease-mediated mutation 2, Jackson
MGI ID: MGI:7786392
Gene: Bicral  Location: Chr17:47109046-47169408 bp, - strand  Genetic Position: Chr17, 22.9 cM
Alliance: Bicralem2(IMPC)J page
IMPC: Bicral gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AGACTTGCTTGGGAGCCTCA and TCTATGTGTCTACACTGTGT. This resulted in a 6,021 bp deletion of Chr17:46,808,139-46,814,159 (GRCm38/mm10) that removes exons ENSMUSE00000323522 through ENSMUSE00000323460. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Bicral Mutation:  322 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory