Bicral^em2(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bicral^em2(IMPC)J
• Name: BRD4 interacting chromatin remodeling complex associated protein like; endonuclease-mediated mutation 2, Jackson
• MGI ID: MGI:7786392
• Gene: Bicral Location: Chr17:47109046-47169408 bp, - strand Genetic Position: Chr17, 22.9 cM
• Alliance: Bicral^em2(IMPC)J page
• IMPC: Bicral gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AGACTTGCTTGGGAGCCTCA and TCTATGTGTCTACACTGTGT. This resulted in a 6,021 bp deletion of Chr17:46,808,139-46,814,159 (GRCm38/mm10) that removes exons ENSMUSE00000323522 through ENSMUSE00000323460. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bicral Mutation: 321 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)