About   Help   FAQ
Adam25em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adam25em1(IMPC)J
Name: ADAM metallopeptidase domain 25; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7785542
Gene: Adam25  Location: Chr8:41205245-41209213 bp, + strand  Genetic Position: Chr8, 23.89 cM
Alliance: Adam25em1(IMPC)J page
IMPC: Adam25 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGGTCTGTCTTCTGACTGAG and AGTTTTCAGTATAGTTCGGA. This resulted in a 2,119 bp deletion of Chr8:40,753,650-40,755,768(GRCm38/mm10) that removes exon ENSMUSE00000373365. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Adam25 Mutation:  45 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory