Rr577em1Krum
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr577em1Krum |
| Name: |
regulatory region 577; endonuclease-mediated mutation 1, Robb Krumlauf |
| MGI ID: |
MGI:7785534 |
| Synonyms: |
B4U- |
| Gene: |
Rr577 Location: unknown Genetic Position: Chr11, Syntenic
|
| Alliance: |
Rr577em1Krum page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: The Hoxb enhancer B4U retinoic acid response element (B4U-RARE) was targeted for binding site disruption using an sgRNA (equivalent to GAGGGGTGAACCGCAGGTCA) and an ssODN template with CRISPR/Cas9 technology, changing it from GGGTGAaccgcAGGTCA to GAATTCaccagTTCTCA.
(J:336097)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr577 Mutation: |
0 strains or lines available
|
|
| Original: |
J:336097 Afzal Z, et al., Shared retinoic acid responsive enhancers coordinately regulate nascent transcription of Hoxb coding and non-coding RNAs in the developing mouse neural tube. Development. 2023 May 15;150(10) |
| All: |
1 reference(s) |
|