Rr50361em2Ddu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr50361em2Ddu |
| Name: |
regulatory region 50361; endonuclease-mediated mutation 2, Denis Duboule |
| MGI ID: |
MGI:7785498 |
| Synonyms: |
Inv(V) |
| Gene: |
Rr50361 Location: Chr2:74127201-74127400 bp Genetic Position: Chr2, Syntenic
|
| Alliance: |
Rr50361em2Ddu page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Inversion
|
| |
|
Mutation details: Putative Hoxd enhancer Rr50361, located between Atp5mc3 and Lnpk, was targeted with sgRNAs (equivalent to TCAAATCGTACAGCGCTGCC and CACGGGGTGGAGTTATCTAC) using CRISPR/Cas9 technology, resulting in a 14,284 bp inversion (GRCm39:chr2:74122565-74136848).
(J:356099)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr50361 Mutation: |
0 strains or lines available
|
|
| Original: |
J:356099 Amandio AR, et al., A complex regulatory landscape involved in the development of mammalian external genitals. Elife. 2020 Apr 17;9 |
| All: |
1 reference(s) |
|