About   Help   FAQ
Rr575em1Ddu
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr575em1Ddu
Name: regulatory region 575; endonuclease-mediated mutation 1, Denis Duboule
MGI ID: MGI:7785480
Synonyms: Del(IV)
Gene: Rr575  Location: unknown  Genetic Position: Chr2, Syntenic
Alliance: Rr575em1Ddu page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsHoxd distal limb enhancer Rr575, located between Atp5mc3 and Lnpk, was targeted with sgRNAs (equivalent to CGCAAAGGCAGATGCGACTT and CTTGCCGCTTGACCTGCTAA) using CRISPR/Cas9 technology, resulting in a 11,106 bp deletion (GRCm39:chr2:74094360-74105465). (J:356099)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr575 Mutation:  0 strains or lines available
References
Original:  J:356099 Amandio AR, et al., A complex regulatory landscape involved in the development of mammalian external genitals. Elife. 2020 Apr 17;9
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory