Rr50361^em1Ddu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr50361^em1Ddu
• Name: regulatory region 50361; endonuclease-mediated mutation 1, Denis Duboule
• MGI ID: MGI:7785479
• Synonyms: Del(V)
• Gene: Rr50361 Location: Chr2:74127201-74127400 bp Genetic Position: Chr2, Syntenic
• Alliance: Rr50361^em1Ddu page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Putative Hoxd enhancer Rr50361, located between Atp5mc3 and Lnpk, was targeted with sgRNAs (equivalent to TCAAATCGTACAGCGCTGCC and CACGGGGTGGAGTTATCTAC) using CRISPR/Cas9 technology, resulting in a 14,269 bp deletion (GRCm39:chr2:74122574-74136842). (J:356099)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr50361 Mutation: 0 strains or lines available

References

• Original: J:356099 Amandio AR, et al., A complex regulatory landscape involved in the development of mammalian external genitals. Elife. 2020 Apr 17;9
• All: 1 reference(s)