Rr567^em1Ddu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr567^em1Ddu
• Name: regulatory region 567; endonuclease-mediated mutation 1, Denis Duboule
• MGI ID: MGI:7785476
• Synonyms: Del(Prox)
• Gene: Rr567 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr567^em1Ddu page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Hoxd enhancer Rr567, located between Lnpk and Evx2, was targeted with sgRNAs (equivalent to ATCTATCACTATTTGCTCCC and ACGATACTTAAGACCTAGTC) using CRISPR/Cas9 technology, resulting in a 13,007 bp deletion (GRCm39:chr2:74444727-74457733). (J:356099)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr567 Mutation: 0 strains or lines available

References

• Original: J:356099 Amandio AR, et al., A complex regulatory landscape involved in the development of mammalian external genitals. Elife. 2020 Apr 17;9
• All: 1 reference(s)