Hexa^{em1(HEXA)Lmjn}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hexa^{em1(HEXA)Lmjn}
• Name: hexosaminidase A; endonuclease-mediated mutation 1, Lauryl Nutter
• MGI ID: MGI:7783624
• Gene: Hexa Location: Chr9:59446966-59472392 bp, + strand Genetic Position: Chr9, 32.02 cM
• Alliance: Hexa^{em1(HEXA)Lmjn} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutations: Insertion, Intragenic deletion
• Hexa^{em1(HEXA)Lmjn} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  HEXA (3073)

  Hexa	(MGI:96073)

• Mutation details:

  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TGGGGTAAGATCGTACACAT and TCATCCCAAGCAAGTACCCC. A single repair template containing the human Hexa sequence, Chr15: 72345960 to 72349474 (hg38) was delivered by incubating embryos with recombinant AAV. In the resulting allele, the mouse exons 8 to 12 and associated introns (from Chr9:59560682 to 59563572 (GRCm39)) are replaced by the human sequence. (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hexa Mutation: 28 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)