About   Help   FAQ
Hexaem1(HEXA)Lmjn
Endonuclease-mediated Allele Detail
Summary
Symbol: Hexaem1(HEXA)Lmjn
Name: hexosaminidase A; endonuclease-mediated mutation 1, Lauryl Nutter
MGI ID: MGI:7783624
Gene: Hexa  Location: Chr9:59446966-59472392 bp, + strand  Genetic Position: Chr9, 32.02 cM
Alliance: Hexaem1(HEXA)Lmjn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inserted expressed sequence)
Mutations:    Insertion, Intragenic deletion
 
Hexaem1(HEXA)Lmjn expresses 1 gene
 
Mutation details: 

This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TGGGGTAAGATCGTACACAT and TCATCCCAAGCAAGTACCCC. A single repair template containing the human Hexa sequence, Chr15: 72345960 to 72349474 (hg38) was delivered by incubating embryos with recombinant AAV. In the resulting allele, the mouse exons 8 to 12 and associated introns (from Chr9:59560682 to 59563572 (GRCm39)) are replaced by the human sequence. (J:322048)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Hexa Mutation:  28 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory