About   Help   FAQ
Rr565em1Timz
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr565em1Timz
Name: regulatory region 565; endonuclease-mediated mutation 1, Tim Zacharewski
MGI ID: MGI:7782633
Synonyms: PkmdeltaDRE
Gene: Rr565  Location: unknown  Genetic Position: Chr9, Syntenic
Alliance: Rr565em1Timz page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe dioxin response element (DRE) in intron 3 of Pkm was targeted using an sgRNA (equivalent to AGGAAGTGGTTATGAAAGCAGGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the deletion of the DRE core sequence GCGTG (GRCm39:chr9:59575386-59575390). (J:358467)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr565 Mutation:  0 strains or lines available
References
Original:  J:358467 Orlowska K, et al., Disruption of canonical AHR-mediated induction of hepatocyte PKM2 expression compromises antioxidant defenses and increases TCDD-induced hepatotoxicity. Redox Biol. 2024 Nov;77:103405
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory