Rr565^em1Timz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr565^em1Timz
• Name: regulatory region 565; endonuclease-mediated mutation 1, Tim Zacharewski
• MGI ID: MGI:7782633
• Synonyms: Pkm^deltaDRE
• Gene: Rr565 Location: unknown Genetic Position: Chr9, Syntenic
• Alliance: Rr565^em1Timz page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The dioxin response element (DRE) in intron 3 of Pkm was targeted using an sgRNA (equivalent to AGGAAGTGGTTATGAAAGCAGGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the deletion of the DRE core sequence GCGTG (GRCm39:chr9:59575386-59575390). (J:358467)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr565 Mutation: 0 strains or lines available

References

• Original: J:358467 Orlowska K, et al., Disruption of canonical AHR-mediated induction of hepatocyte PKM2 expression compromises antioxidant defenses and increases TCDD-induced hepatotoxicity. Redox Biol. 2024 Nov;77:103405
• All: 1 reference(s)