About   Help   FAQ
Mir678em2(IMPC)Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Mir678em2(IMPC)Ics
Name: microRNA 678; endonuclease-mediated mutation 2, Mouse Clinical Institute
MGI ID: MGI:7781827
Gene: Mir678  Location: Chr10:76043160-76043243 bp, - strand  Genetic Position: Chr10, 38.74 cM
Alliance: Mir678em2(IMPC)Ics page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 2 sgRNAs (equivalent to ATGTCCGCATCTTGTGTCAG and CTACCCATGCAGAGTCCACT) and a 451 nt ssODN template, resulting in the introduction of loxP sites flanking the single exon (ENSMUSE00000660428; GRCm39) located in the Prmt2 3' UTR. (J:358405)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mir678 Mutation:  3 strains or lines available
References
Original:  J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory