Prune1^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prune1^em1(IMPC)Ics
• Name: prune exopolyphosphatase; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:7781825
• Gene: Prune1 Location: Chr3:95160985-95189387 bp, - strand Genetic Position: Chr3, 40.74 cM
• Alliance: Prune1^em1(IMPC)Ics page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: This allele was generated at the Institut Clinique de la Souris by co-electroporating Cas9 protein, a crRNA (CTTACTTGGGTAAAATATGG)/tracrRNA and an ssODN template, which resulted in a p.D106N mutation in exon 3 (ENSMUSE00000253496; GRCm39). A DdeI diagnostic restriction site was introduced to facilitate genotyping. (J:358405)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prune1 Mutation: 112 strains or lines available

References

• Original: J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024
• All: 1 reference(s)