About   Help   FAQ
Dyrk1aem1(IMPC)Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Dyrk1aem1(IMPC)Ics
Name: dual-specificity tyrosine phosphorylation regulated kinase 1a; endonuclease-mediated mutation 1, Mouse Clinical Institute
MGI ID: MGI:7781823
Gene: Dyrk1a  Location: Chr16:94370869-94496376 bp, + strand  Genetic Position: Chr16, 55.3 cM
Alliance: Dyrk1aem1(IMPC)Ics page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsThis allele was generated at the Institut Clinique de la Souris by co-electroporating Cas9 protein, a crRNA (CAAGCAGCCGCACTTCTATC)/tracrRNA and an ssODN template, which resulted in a p.A195T mutation in exon 6 (ENSMUSE00000131727; GRCm39). An XmnI diagnostic restriction site was introduced to facilitate genotyping. (J:358405)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dyrk1a Mutation:  114 strains or lines available
References
Original:  J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory